Iso 22000

Disponible uniquement sur Etudier
  • Pages : 5 (1079 mots )
  • Téléchargement(s) : 0
  • Publié le : 5 avril 2011
Lire le document complet
Aperçu du document
LES PUCES A ADN
Rémi Bernard

Graphics courtesy of the National Human Genome Research Institute

Cellule Chromosome

transcription

traduction

Gène (ADN)
À l’échelle cellulaire

Transcrit (ARNm), Simple brin

Protéine

GENOME
(ensemble des gènes d’une cellule)

TRANSCRIPTOME
(ensemble des transcrits d’une cellule à un instant donné)

PROTEOME

(ensemble des protéinesprésentes dans une cellule à un instant donné

ETUDE DU GENOME

GENOMIQUE

ETUDE DU TRANSCRIPTOME ETUDE DU PROTEOME

POST-GENOMIQUE

Dans une cellule seulement une fraction des gènes est exprimée ...

Tissu nerveux

Tissu musculaire

Autre exemple: au cours d’une croissance bactérienne… Les conditions de milieu changent et les gènes exprimés aussi !
Phase Début de phase stat.stationnaire Phase Expo.

DO 600 nm

Temps (min)
Gènes de croissance (metabolisme…) Gènes de mobilité (flagelle) Gènes de carence… Gènes de survie (sporulation..) Gènes de défense (production d’antibiotique…)

Un des outils pour l’étude du transcriptome: les biopuces ou puces à ADN
Le but: détecter et quantifier chacune des différentes espèces d’ARNm présents dans la préparation. Analyserle transcriptome c’est identifier, à un temps t, et/ou dans une condition donnée, les séquences codantes du génome effectivement exprimées (transcrits, ou ARNm).

L’ ADNc ou ADN complémentaire
exon intron ADN génomique, double brin

In vivo

…GAAATAAGCTGTTCTCTGCTTCAT…
Brin codant

…CTTTATTCGACAAGAGACGAAGTA…

transcription ARN messager, simple brin
(instable)

…GAAAUUCUGCUUCAU…
Invitro

rétro-transcription …CTTTAAGACGAAGTA…

ADNc, simple brin (stable)

L’ADNc ne contient que les régions codantes d’un gène (élimination des introns)

Fabrication des puces à ADN

LE BUT: représenter sur la puce l’ensemble des transcrits d’un génome et pouvoir les identifier

2 types de sondes fixées sur le support solide
intron exon

ADN génomique du gène 1

ADNc Gene 1Fragment spécifique complémentaire simple brin

PCR

(amplification d’un fragment codant spécifique)

(obtenu par : -oligosynthèse - synthèse in situ (photolitographie)

Chaque position sur la puce est connue

Chaque dépôt contient des fragments spécifiques d’un seul gène. L’ensemble des gènes du génome étudié doivent être représentés si possible sur la puce. Ces fragments fixés sur la pucesont les sondes et ne sont pas marqués.

LES CIBLES

Préparation Population cellulaire (echantillon biologique)

Extraction des ARNm totaux
Reverse transcription et marquage

Obtention d’ADNc totaux marqués

Hybridation de ces ADNc sur la puce

Deux marquages possibles

ADNc marqués

[P33] dCTP
ARNm totaux

Marquage radioactif

Populations cellulaires Marquage avecfluorochromes ARNm totaux

Cy3 CyX dCTP Cy5
ADNc marqués

Interaction entre la sonde et la cible: HYBRIDATION MOLECULAIRE
Lame de verre comportant les sondes fixées

Cible: ADNc du gène X
…TCCCAGCTGAAT…

dépôt contenant les sondes spécifiques du gène X

GT CG AC TT AG A GG TC AG GA GG CT TC TA GA CT TA

AG G

TC CC AG AG CT GG GA TC GA A CT T… TA



Hybridation: interaction des deuxchaînes de séquences complémentaires
(liaisons hydrogènes)

Quantification des transcrits présents:

Le signal de détection est proportionnel à la concentration de la cible

Condition: excès de sondes (sur la puce) par rapport aux cibles (venant s’hybrider sur cette puce)

Plusieurs types de puces

Analyse des résultats sur une lame de microarray
Population cellulaire 2
(ex:cellules cultivées sans oxygène) (cellules références)

Population cellulaire 1

ARNm totaux ADNc marqués fluorochrome1 (CY5-dCTP)
Hybridation sur la puce

ARNm totaux ADNc marqués fluorochrome2 (CY3-dCTP)

Excitation 1

Analyse des résultats:
Quantification de chacune des fluorescences pour chacun des dépôts (gènes) de la lame Classification des gènes sur un graphe de type suivant...
tracking img