Sciences de la vie

Disponible uniquement sur Etudier
  • Pages : 2 (270 mots )
  • Téléchargement(s) : 0
  • Publié le : 2 novembre 2010
Lire le document complet
Aperçu du document
Question 1 : définir le phénotype à plusieurs échelles
Enzyme G6PD active : eau oxygénée transformée phénotype moléculaire sain
Enzyme G6PD inactive : eau oxygénée nontransformée phénotype moléculaire malade
Hématie fonctionnelle, sans eau oxygénée phénotype cellulaire sain
Hématie détruite par l’accumulation d’eau oxygénée phénotypecellulaire malade
Pas de symptômes, bonne respiration des organes phénotype macroscopique sain
Crises d’anomalie respiratoire phénotype macroscopique malade
EXERCICE 2 PAGE 64 :HORMONE ET CODE GENETIQUE
1° partie de la question : découpage des séquences en triplet
TGCTACATCCAGAACTGCCCCCTGGGC
On sait que le code génétique est organisé en triplet
TGCTAC ATC CAG AAC TGC CCC CTG GGC.
2° partie de la question : séquence d’acides aminés des deux hormones
CYSTEINE TYROSINE ISOLEUCINE GLUTAMINE ASPARAGINE CYSTEINE PROLINELEUCINE GLYCINE
EXERCICE 3 PAGE 65 : SEQUENCE DE GENE A PARTIR DE LA PROTEINE

MET- enképhaline = MET-PHE-GLY-GLY-TYR
On sait que les acides amines correspondent à un ouquelques triplets de nucléotides.
À partir du code génétique : MET désigné par ATG
PHE TTT ou TTC
GLY GGT ou GGC ou GGA ou GGG
TYR TAT ou TAC ou TAA
Pour les acides aminésPHE, GLU et TYR, il y a plusieurs triplets possibles. Il n’y a donc pas une seule séquence de nucléotides pouvant déterminer cette séquence d’acides aminés.
Question 2 :nombre de séquences génétiques possibles
MET : 1 triplet ; PHE : 2 triplets ; GLY : 4 triplets ; 2 molécules successives de GLY ; TYR : 3 triplets.
Le nombre de possibilités deséquence de nucléotides différentes correspond au nombre de combinaisons possibles de ces triplets : 1 x 2 x 4 x 4 x 3 = 96 combinaisons possibles : 96 séquences différentes
tracking img