Expression Stabilité Et Variabilité Du Patrimoine Génétique dissertations et fiches de lecture

  • Expression, stabilité et variabilité du patrimoine génétique

    Partie 1 : Expression, stabilité et variabilité du patrimoine génétique 1) Reproduction conforme et réplication de l’ADN : A) Le cycle cellulaire : Le cycle cellulaire est l’ensemble des phases qui va d’une division cellulaire à une autre. Chez les eucaryotes (tous les organismes qui ont un noyau dans leur cellule), cette division se fait par mitose. L’interphase est la phase qui prépare la division cellulaire, l’ADN est décondensé donc les chromosomes ne sont pas distingués au microscope. L’ADN...

    1483  Mots | 6  Pages

  • Thème 1 , 1S Expression, stabilité et variation du patrimoire génétique

    THEME 1 Expression, stabilité, variation du patrimoine génétique Chapitre 1 : Reproduction conforme de la cellule et réplication de l'ADN La cellule est la plus petite unité structurale et fonctionnelle des êtres vivant. Elle possède un patrimoine génétique sous forme de molécules d'ADN. Depuis Pasteur, on sait que les cellules proviennent de la division d'autre cellules. Lorsque les cellules filles possèdent les mêmes caractéristiques que la cellule même d'origine, on parle de reproduction...

    2960  Mots | 12  Pages

  • Chapitre 1 la genetique

    Thème 1-A Expression, stabilité et variation du patrimoine génétique Classe : Première S Durée conseillée : 6 semaines Nombre de TP : En rouge : Bilans à faire noter aux élèves En bleu : Activités pratiques En vert : Problématique et hypothèses RAPPELS http://www.cea.fr/var/cea/storage/static/fr/jeunes/animation/aLaLoupe/ADN/index.htm 1 – La cellule : - Cellule : Les cellules sont constituées d’une membrane plasmique, d’un cytoplasme et d’un noyau. - Eucaryotes : Cellules qui possèdent...

    5423  Mots | 22  Pages

  • Génétique des populations

    Génétique des populations. I/ Introduction. Darwin (1809-1882) : 1859 « l’origine des espèces », 2 messages : les êtres vivants évoluent, l’histoire de la vie est un arbre/ la sélection naturelle explique l’évolution. Mais pas de proposition de mécanisme pour expliquer l’évolution des caractères. Mendel (1822-1884) : proposition d’un mécanisme de transmission des caractères simples discrets : lois d’hérédité. Thomas Hunt Morgan (1866-1945) : professeur d’embryologie, expérimente sur les drosophiles...

    4036  Mots | 31  Pages

  • Les innovations génétiques

    Chapitre 8 : Les innovations génétiques Le génome de chaque être vivant est constitué de molécule d’ADN portant des gènes. Le phénotype est l’ensemble des caractères observables d’un être vivant, il s’exprime à plusieurs échelles : moléculaire, cellulaire, macroscopique. Le phénotype dépend directement ou indirectement des différentes protéines. Un gène peut présenter plusieurs versions différentes (Allèles) qui diffèrent par leurs séquences nucléotidiques : il y a polyallèlisme. Comment...

    911  Mots | 4  Pages

  • Français

    La Terre dans l’Univers, la vie et l’évolution du vivant : expression, stabilité et variation du patrimoine génétique. Introduction : - La biodiversité est à la fois la diversité des écosystèmes, la diversité des espèces (interspécifique) et la diversité génétique des individus au sein des espèces (intraspécifique) ; elle est due aux mécanismes de l’évolution (mutation, dérive génétique aléatoire, sélection naturelle et migration) au cours du temps. - Chez un organisme, le développement embryonnaire...

    2199  Mots | 9  Pages

  • INFORFMATION GENETIQUE, STABILITE ET VARIABILITE

    PARTIE 1: INFORFMATION GENETIQUE, STABILITE ET VARIABILITE CHAPITRE I: Biochimie des acides nucléiques Objectifs: - comprendre et connaître la structure des ADN et ARN - savoir définir les molécules de bases - savoir dessiner les ADN et ARN à plusieurs nivaux de précision - connaître quelques applications technologiques et médicales I. LES NUCLEOTIDES MONOMERES Les Nucléotides sont en quelque sorte des «briques...

    1121  Mots | 5  Pages

  • Corriges svt bordas 1ere s

    Partie 1 chapitre 2 Variabilité génétique et mutation de l’ADN Activités pratiques 1 Capacités et attitudes L’origine d’une variabilité de l’ADN (p. 32-33) Connaissances Pendant la réplication de l’ADN surviennent des erreurs Recenser, exploiter et interpréter des bases de données spontanées et rares, dont la fréquence est augmentée pour mettre en évidence l’influence d’agents mutagènes par l’action d’agents mutagènes. L’ADN peut être aussi sur des populations humaines (UV, benzène, etc.)....

    4989  Mots | 20  Pages

  • Dgs tfc

    Expression, stabilité et variabilité du patrimoine génétique. Exercice: patrimoine génétique et santé humaine Compétences testées : | 1 | 2 | 3 | 4 | 5 | Recenser, extraire, organiser les informations utiles (C2)  | | | | | | Appliquer une démarche explicative. Argumenter (C4d)  | | | | | | Etre conscient de ses responsabilité face à l’environnement et à la santé (C6)  | | | | |...

    2781  Mots | 12  Pages

  • Cours

    EXPRESSION, STABILITE ET VARIATION DU PATRIMOINE GENETIQUE VARIABILITE GENETIQUE ET SANTE Introduction : Les variations génétiques sont à l’origine de la grande diversité des caractères présentés par les êtres vivants. Elles sont aussi responsables de nombreuses maladies chez l’Homme telles que la mucoviscidose ou les cancers et responsables de l’apparition de microorganismes pathogènes résistants aux traitements antibiotiques par exemple. La compréhension des mécanismes d’apparition et...

    2483  Mots | 10  Pages

  • génétique

    UNIVERSITE DE OUAGADOUGOU --------------------------------Unité de Formation et de Recherche En Sciences de La Santé U.F.R. – S.D.S. COURS DE GENIE GENETIQUE Cellule Noyau cellulaire Double brin d’ADN Chromosome …AATCTTGCCGGGTTCCCG… …AATCGCCGTCCGATTCCGTCACGC… …TTAGAACGGCCCAAGGGC… ….TTAGCGGCAGGCTAAGGCAGTGCG… NOTES DU COURS: Prof. Jacques K. SIMPORE, 1 Le Serment éthique pour les chercheurs en sciences de la vie, adapté et inspiré du Serment d'Hippocrate médical...

    36133  Mots | 145  Pages

  • Exercices génetique

    STABILITE ET VARIABILITE GENETIQUE AU SEIN D’UNE MEME ESPECE : exercices Question 1 : Question 2A : sachant que pour chaque caractère étudié la différence phénotypique est liée à un seul gène, dire, à partir des informations extraites du document, si les deux gènes considérés sont situés sur le même chromosome ou deux chromosomes différents. Croisement 1: On croise des drosophiles de lignées pures : un mâle à abdomen rayé et au thorax dépourvu de soies et une femelle dont l'abdomen est uni et le...

    2536  Mots | 11  Pages

  • La reproduction conforme des cellules

    Thème : Expression, stabilité et variabilité du patrimoine génétique. Révisions Leçon 1 : La reproduction conforme des cellules. Problématique : Comment les informations génétiques se transmettent-elles d’une génération cellulaire à la suivante ? 1 Les chromosomes, éléments permanents des cellules (voir diaporama 1-1). Les chromosomes sont des éléments permanents des cellules. En interphase, les chromosomes sont dans un état décondensé. Au début de la mitose, la molécule d'ADN s'enroule...

    521  Mots | 3  Pages

  • Stabilite et variabilité des génomes

    Stabilité et variabilité des génomes Lors d'une mitose , l'information génétique de la cellule mère et transmise à chaque cellule fille. Ce qui assure une stabilité du génome. Au cours de différente division les indications d'une espèce garde toujours le même nombre de gène. Cependant lors des réplications d'ADN spontanément ou sous l'effet de l'environnement il peut se produire des mutation à l'origines des nouveaux allèles mais également de nouveaux gènes : il y a donc une variabilité du...

    581  Mots | 3  Pages

  • Cours svt stabilité et variabilité des génômes et évolution

    Les innovations génétiques Quand on observe un caractère donné, un élément de notre phénotype, on constate une grande variabilité dans les états de ce caractère. Pourtant d'après les mécanismes de l'évolution, l'information génétique d'un individu doit découler de ses parents. Comment se réalisent ces variations de l'information génétique, au niveau de l'individu et de l'espèce? Rappel de vocabulaire: Phénotype: Ensemble des carractères observable à toute les échelles du vivant (atome, molécule...

    2429  Mots | 10  Pages

  • Stabilité et variabilité des génomes et évolution

    PARTIE 2 : Stabilité et variabilité des génomes et évolution CHAPITRE 1 : L’APPORT DE L’ETUDE DES GENOMES : LES INNOVATIONS GENETIQUES INTRODUCTION : Faire le point p 84/85 Tous les individus d’une même espèce possèdent le même génome, avec des allèles différents : c’est le polymorphisme. Des accidents génétiques comme les mutations et les duplications enrichissent le génome expliquant la grande diversité actuelle des êtres vivants. Ces innovations génétiques ont des conséquences variées...

    2833  Mots | 12  Pages

  • Déterminisme génétique

    - PLANCHE- bm Le déterminisme génétique et la liberté de choix Est-ce que nous sommes libres de choisir ou de créer notre comportement (ce qui suppose un libre arbitre) ? Ou est-ce que nos comportements sont dictés par les lois de la nature (c’est le déterminisme) ? Tous les êtres vivants possèdent de l’ADN, c’est le support de l’information génétique qui différencie chaque humain. L’homme n’est d’abord rien. Il ne sera qu’ensuite, et il sera tel qu’il se sera fait. Ou tel que la...

    3997  Mots | 16  Pages

  • Variabilité

    Thème 2 Stabilité et variabilité des génomes et évolution Comment évolue le génome ? 1/Rappels du génotype au phénotype A/Le phénotype Ensemble des caractères qui définissent un individu. B/Le gène Un chromosome est une molécule d'ADN qui peut porter des miliers de gènes. Un gène est une séquence de nucléotides qui code pour la séquence d'acides aminés d'une protéine. (+code génétique) 2/Les innovations génétiques A/Le polyallélisme 1/Définition Un allèle est une version...

    1044  Mots | 5  Pages

  • génétique bacterienne

    Génétique bactérienne Étude du génome et de son organisation Étude de l’expression des gènes (aussi complexe que chez les eucaryotes!) Étude de la transmission de l’hérédité et de sa variabilité Arbre phylogénétique Point d’origine inconnue: même ancêtre entre les bactéries et les eucaryotes? Génome Les bactéries contiennent un chromosome unique et circulaire qui porte toute l’information génétique. Le génome bactérien est composé une molécule d’ADN db (duplex). Condensé...

    1337  Mots | 6  Pages

  • Méiose, fécondation et variabilité des individus

    Partie II : Stabilité et variabilité des génomes – Evolution Chapitre 3 : Méiose, fécondation et variabilité des individus Mots clés : * Gènes liés : gènes portés par la même paire de chromosome * Gènes non liés : gènes portés par des paires de chromosomes différentes * Locus : emplacement d'un gène sur un chromosome * Brassage inter chromosomique : répartition aléatoire et indépendante des paires de chromosomes, à l'anaphase de première division méiotique. ...

    1409  Mots | 6  Pages

  • Méiose, fécondation et variabilité des individus

    MEIOSE, FECONDATION ET VARIABILITE DES INDIVIDUS Les individus issus de la reproduction sexuée présentent tous des caractéristiques communes à leur espèce cependant ils témoignent d'une grande diversité phénotypique qui reflète la diversité de leur patrimoine génétique (leur génotype). A l'exception des vrais jumeaux, chaque individu est unique. Comment méiose et fécondation contribuent-elles à la diversité génétique des individus ? I- Variabilité des individus Chez les haploïdes ...

    634  Mots | 3  Pages

  • Innovations génetiques

    Les innovations génétiques Dans toute espèce, le support de l’information génétique est l’ADN, répliqué et transmis au cours des divisions cellulaires. L’ADN détermine, en relation avec l’environnement, le phénotype des individus de l’espèce. Observé à l’échelle moléculaire, le polymorphisme individuel est très important, soulevant la question de son acquisition et de son maintien au cours de l’histoire de l’espèce. I – Le génome d’une espèce présente un polymorphisme 1) Le polymorphisme...

    1246  Mots | 5  Pages

  • Innovation génétique

    Partie 2 : Stabilité et variabilité des génomes Ch.4 Relations entre innovations génétiques et évolution des espèces Objectif : On cherche à savoir l’incidence des innovations génétiques sur l’évolution des espèces. | | | | |Date |Activités et déroulement des activités ...

    1129  Mots | 5  Pages

  • évaluation expression et variabilité du programme génétique

    Evaluation expression et variabilité du programme génétique Nom : Prénom : Exercice 1 De l’ADN à la protéine : / 5 Deux allèles mutés du gène d’un peptide (petite protéine) de 6 acides aminés impliqués dans le système nerveux (neuropeptide) ont été mis en évidence : le nucléotide n°15 C du brin transcrit est substitué par le nucléotide T (mutation n°1), le nucléotide n°7 A du brin transcrit est substitué par le nucléotide...

    643  Mots | 3  Pages

  • Innovations genetiques

    Chapitre 4 : Les innovations génétiques Introduction : Au sein d'une espèce, le polymorphisme des séquences d'ADN résulte de l'accumulation de mutations au cours des générations successives. Suivant leur nature et leur localisation, les mutations (substitution, addition ou délétion d'un ou plusieurs nucléotides) ont des conséquences phénotypiques variables. Au sein du génome d'une espèce, les similitudes entre gènes (familles de gènes) sont interprétées comme le résultat d'une ou plusieurs...

    3627  Mots | 15  Pages

  • Les mutations génétiques

    Les Mutations Génétiques Intro : Le terme mutation est utilisé pour désigner une modification irréversible de l'information génétique, aboutissant à une variation de l'information transmise par un gène. Tous les êtres vivants sont concernés par ces mutations génétiques. Mais quelles sont les causes d'une mutation, et ses effets sur un être vivant ? Pour répondre à cette problématique, il faudra dans un premier temps chercher les facteurs responsables de ces mutations, la manière dont elles se...

    633  Mots | 3  Pages

  • 246746774 Corrige Svt 1er S Bordas

    ................................................................................... Partie 1 Expression, stabilité et variation du patrimoine génétique Chapitre 1 Chapitre 2 Chapitre 3 Chapitre 4 Partie 2 3 5 Reproduction conforme et réplication de l’ADN ......................... Variabilité génétique et mutation de l’ADN ................................... L’expression du patrimoine génétique ............................................. Génotype, phénotype et environnement ................

    88409  Mots | 224  Pages

  • Influences génétiques et psychosociales sur le développement cognitif: une question d'interactions

    Franck Ramus Chargé de recherches au CNRS Laboratoire de sciences cognitives et psycholinguistique (EHESS/CNRS/DEC-ENS) Influences génétiques et psychosociales sur le développement cognitif : une question d’interactions Article paru dans Le Journal des psychologues n°251, Octobre 20071 Les neurosciences et la psychanalyse présentent des désaccords persistants sur la question des causes de la plupart des troubles du développement cognitif. La première approche met en évidence des facteurs biologiques...

    3526  Mots | 15  Pages

  • Le brassage génétique et sa contribution à la diversité génétique

    Thème 1 : La Terre dans l’univers, la vie, l’évolution du vivant Thème 1-A : Génétique et évolution Chapitre 1 : Le brassage génétique et sa contribution à la diversité génétique I- Notion de cycle biologique (= de développement) L’étude du caryotype permet de déterminer la ploïdie d’une cellule. Les cellules somatiques possèdent deux exemplaires de chromosomes : les chromosomes identiques sont dits homologues et sont organisés par paire ; la cellule est diploïde. Les cellules sexuelles (gamètes)...

    1019  Mots | 5  Pages

  • Cours 1 et 2 génétique

    design) effectuent un retour au créationnisme (dieu a tout crée d'un coup de baguette magique). CHAPITRE 1. GÉNÉTIQUE ET ÉVOLUTION DES ESPÈCES (11 semaines) ACQUIS p.8 à 11 à connaître. Partie de la biologie qui traite de l'étude du matériel héréditaire donc de l'ADN (ac desox nucl). L'importance de l'ADN dans la réalisation des caractères d'un individu explique ce rapprochement entre génétique et évolution: pour que l'on observe des transformations dans les caractères on est forcé d'imaginer des modifications...

    2031  Mots | 4  Pages

  • Chapitre 1 PLESSIS NADAL Acides Nucleiques 30 01 2015

    LICENCE L1 Biologie moléculaire et génétique 1 (30BU02SV) Cours: Anne Plessis & Marc NADAL mailto:plessis@ijm.univ-paris-diderot.fr mailto:nadal@ijm.univ-paris-diderot.fr Responsable de l’UE: Véronique Joliot veronique.joliot@univ-paris-diderot.fr Intervenants TD + TP Véronique Arluison Claude Bazin Fany Bourgois-Rocha Mégane Brusson Sandra Claret 15/02/2015 Antonin Counillon Anne Filipe Nathalie Janel Véronique Joliot Alexis Lalouette India Leclercq Sophie Malinsky Dorian Obino Jean-François...

    3495  Mots | 14  Pages

  • Biotechnologies et conservation des ressources génétiques à l’ipgri (institut international des ressources phytogénétiques)

    Dl1 : Biotechnologies et conservation des ressources génétiques à 1’IPGRI (Institut international des ressources phytogénétiques) ENGELMANN LPGRI (Institut International F. Via delle Sette Chiese / i des Ressources Phytogénétiques). 142, 00145 Rome, Italie. INTRODUCTION L’IPGRI (Institut international des ressources phytogénétiques), successeur de I’IBPGR (Bureau international pour les ressources phytogénétiques). est une organisation internationale autonome qui opère sous l’égide...

    10406  Mots | 42  Pages

  • Autre Cours Genetique Mutation

    Chapitre  2  -­  VARIABILITÉ  GÉNÉTIQUE  ET  MUTATION  DE  L’ADN   Les  organismes  ne  peuvent  survivre  que  si  leur  ADN  est  soigneusement  répliqué  et  protégé  des   altérations  chimiques  et  physiques  qui  pourraient  changer  ses  propriétés  codantes.   La  vie  et  la  biodiversité  résultent  d’une  balance  subtile  entre  mutations  et  réparations.   Les  mutations  introduisent...

    1925  Mots | 8  Pages

  • questions de corpus

    odontologie, diététique, épidémiologie pour le Thème 3. THEME 1 : La Terre dans l’Univers, la vie et l’évolution du vivant Partie I : Expression, stabilité et variation du patrimoine génétique. Chapitre 1 : Reproduction conforme et réplication de l’ADN Chapitre 2 : Variabilité, génétique et mutation de l’ADN Chapitre 3 : L’expression du patrimoine génétique Chapitre 4 : Génotype, phénotype et environnement Partie II : la tectonique des plaques : histoire d’un modèle Chapitre 1 : La naissance...

    2086  Mots | 9  Pages

  • Dm svt génétique ts

    raisonnement scientifique 3 points Stabilité et variabilité des génomes et évolution Nombre de gènes déterminant un caractère On formule l’hypothèse que chez le poulet d’Andalousie la couleur du plumage est gouvernée par un seul couple d’allèles. ( Analysez les croisements présentés dans le document et indiquez si leurs résultats sont conformes à cette hypothèse. [pic] Partie 2.2 : (5 points) Stabilité et variabilité des génomes et évolution bac S septembre 2006...

    939  Mots | 4  Pages

  • Sonnet helene

    la vie et l’évolution du vivant Thème 1 - A Expression, stabilité et variation du patrimoine génétique Ce thème s’appuie sur les connaissances acquises en collège et en classe de seconde sur la molécule d’ADN. Il s’agit de comprendre comment la réplication et la mitose permettent une reproduction cellulaire conforme. Toutefois, la fragilité de la molécule d’ADN - notamment lors de la réplication - est source de mutation, cause de variation génétique. Les mécanismes de transcription et traduction...

    7231  Mots | 29  Pages

  • Brassage génétique

    LE BRASSAGE GENETIQUE PAR LA MEÏOSE ET LA FECONDATION Certains êtres vivants, les bactéries ou les levures par exemple, se multiplient par mitoses successives c'est une reproduction asexuée. Tous les individus obtenus héritent du même bagage génétique et constituent donc un clone. La reproduction sexuée a des conséquences totalement différentes: chaque descendant hérite d'un assortiment unique de gènes, pour moitié d'origine paternelle et pour moitié d'origine maternelle. En effet, la méiose...

    1703  Mots | 7  Pages

  • Adn, unité et diversité du vivant

    Théme 1 – Chap 3 : ADN, unité et diversité du vivant. L’information génétique est, chez les eucaryotes, contenue dans les noyaux des cellules. Cette information gouverne l’activité de la cellule. Elle est transmise de cellule en cellule lors de la division cellulaire. Le support de l’information génétique est le chromosome. 1- L’organisation moléculaire des chromosomes Les chromosomes sont le support du programme génétique. Bien visible au microscope optique lors de la division cellulaire,...

    1411  Mots | 6  Pages

  • Genetique Et Informatique

    Introduction aux acides nucléiques En fait, c'est l'ADN, ou acide désoxyribonucléique, qui est responsable de la structure des protéines. Il fait partie, avec l'ARN, de la famille des acides nucléiques. L'ADN doit également transmettre le message génétique à la progéniture de l'organisme et aux générations successives de cellules qui proviennent de cette cellule souche. L'ADN est donc le support de l'hérédité et il possède toutes les informations nécessaires pour que la cellule accomplisse ses fonctions...

    52174  Mots | 176  Pages

  • Génétique

    Allèle « B » du gène OAC2 : expression du gène = production d'une protéine Pb très active. Le pH des mélanosomes du mélanocyte est ainsi très faible, très acide. La tyrosinase est ainsi dans des conditions de pH où son activité est faible. Peu de tyrosine est transformé en mélanine dans les mélanocytes. Peu de mélanine est exportée vers les kératinocytes et la pigmentation de la peau est peu marquée et donc de couleur blanche. Allèle « N » du gène OAC2 : expression du gène = production d'une...

    654  Mots | 3  Pages

  • Psychologie de la personnalité

    base qui sont universels. Existence réelle des traits ? o Comme pour la plupart de concepts psychologique, c’est surtout une abstraction que nous faisons à partir des indicateurs observables, de leurs effets. Il n’y a pas de localisation (bio, génétique, comportementale), unique. o On peut essayer de localiser des traits sur ces plans, mais la manifestation des traits. Mais ce ne sont pas des localisations uniques, ce sont des approximations. On postule leur existence par leurs manifestations. ...

    17605  Mots | 71  Pages

  • Programme TS SVT

    de la science fondamentale Enjeux planétaires contemporains Univers métier de la gestion publique et de l’environnement Le corps humain et la santé Univers métier de la santé TS Énergie et cellule vivante Génétique et évolution: Brassage, méiose, fécondation, Diversification génétique, des êtres vivants, Spéciation Evolution de l’Homme, La vie fixée chez les plantes Le domaine continental et sa dynamique : tectonique des plaques et reliefs terrestres 1S 1S Glycémie et diabète Rôle des enzymes...

    6346  Mots | 58  Pages

  • Cours d'svt

    CORRIGE DU BACCALAURÉAT SERIE S Session 2008 METROPOLE SCIENCES DE LA VIE ET DE LA TERRE Q1 : RESTITUTION ORGANISEE DES CONNAISSANCES (sur 8 points) INTRODUCTION Toutes les espèces vivantes ont pour support de leur patrimoine génétique une ou des molécules d’acide nucléique et des chromosomes en nombre constant au fil des générations. Ainsi l’espèce humaine, diploïde, possède-t elle 2n = 46 chromosomes (notés par la suite CHR) alors que le Champignon Sordaria, haploïde, en possède n =7. La transmission...

    685  Mots | 3  Pages

  • Le patrimoine

    Le patrimoine Toutes les richesses faisant l’objet d’une appropriation privée tombent dans le patrimoine. C’est à la fois une notion familière de sens commun et une construction abstraite de la doctrine juridique. Juridiquement, le patrimoine est l’ensemble des droits et obligations appartenant à une personne et ayant une valeur pécuniaire. La théorie du patrimoine est récente. Elle a été l’œuvre au 19ème siècle d’Aubry et Rau puis a été critiquée. Elle demeure pourtant malgré les contestations...

    1151  Mots | 5  Pages

  • la monarchie dans la littérature

    Chapitre3 : Expression du patrimoine génétique I.La nature chimique des protéines Les protéines sont des molécules biologiques qui résultent de la polymérisation d’acides aminés en une ou plusieurs chaînes polypeptidiques. Le nombre, la nature et l’ordre d’enchaînement des acides aminés définissent la séquence de la protéine ou structure primaire. II.La relation entre gène et protéine Les gènes, fragments d’ADN codent la synthèse des protéines, molécules polymères d’acides aminés responsables...

    724  Mots | 3  Pages

  • Chap 2 Et 3

    facteurs environnementaux, dits agents mutagènes, peuvent favoriser l'apparition de mutations. Il existe également un système de réparation de l'ADN qui limite le nombre de mutations, sans être efficace à 100 %. Les mutations sont sources de variabilité génétique, mais peuvent être transmises à la descendance de l'individu uniquement si elles affectent des cellules appelées germinales. I-Les modifications de l'ADN A)Les différents types de mutations Une mutation est une modification de la séquence...

    1555  Mots | 6  Pages

  • Méthodes en génétique

    Méthodes en Génétique I-Caractères simples A-Equilibre de Hardy-Weinberg B-Sélection C-Effet fondateur D-Consanguinité E-Exemple de la mucoviscidose II-Hérédité complexe A-Hérédité polygénique: modèles de maladies B-Caractères quantitatifs, héritabilité C-Importance des gènes dans les maladies courantes D-Interaction gènes-environnement III-Calcul de risque A-Caractères simples (maladies liées à l'X) B-Caractères simples (maladies dominantes) C-Hérédité complexe La génétique est une science...

    5185  Mots | 21  Pages

  • Test génétiques

    Tests génétiques et impacts sur la société Rédigé par Sandrine de Montgolfier MC Epistémologie et histoire des sciences / Biotechnologie Université Paris 12 – IRIS (Institut de Recherche Interdisciplinaire sur les enjeux Sociaux. Sciences sociales, politique, santé) Résumé La médecine prédictive a pour concept le fait d'annoncer un évènement pathologique pouvant survenir chez un individu bien portant. Elle est fondée sur la notion de dépistage des personnes à risques et elle est en lien avec...

    4756  Mots | 20  Pages

  • Vaccins et mémoire immunitaire

    virus ou de bactéries vivants atténués par un système de cultures successives, destinées à ne conserver que les formes mutantes non pathogènes (Rougeole). Les nouvelles techniques de production de vaccins ont vu le jour grâce aux progrès du génie génétique. Elles ont notamment permis de fabriquer des micro-organismes artificiels non pathogènes vaccinants. Ceux-ci correspondent à des virus ou à des bactéries totalement inoffensifs pour l'homme, auxquels on fait produire une protéine antigénique spécifique...

    1373  Mots | 6  Pages

  • rapport de master l'étude de l'enzyme la pyrophosphatase inorganique chez TETERAHYMENA

    leur a permis d’être introduits très tôt dans le laboratoire. Leur intérêt résulte aussi de fait qu’ils sont très différents des autres microorganismes. Les ciliés sont parmi les premiers organismes à être utilisés pour comprendre le phénomène génétique des eucaryotes. Parmi les protozoaires ciliés, Tetrahymena est l’un des genres les plus étudiés. Les espèces appartenant à ce genre, comme Tetrahymena thermophila et Tetrahymena pyriformis, représentent un système expérimental très utile en...

    6272  Mots | 26  Pages

  • Tp5 les mutations

    THEME 1A – Expression, stabilité et variation du patrimoine génétique TP5 – La variabilité de l’ADN : les mutations Certains produits chimiques (molécules cancérigènes …) et rayonnements (UV, rayons gammas, rayons X) sont dangereux pour la santé. Nous savons qu’ils peuvent désorganiser le fonctionnement de la cellule en produisant des mutations. Nous allons voir un exemple concret de mutation chez les levures (Saccharomyces cerevisiae, souche Ade 2) à la suite d’une irradiation par les UltraViolets...

    2189  Mots | 9  Pages

  • La r gulation de l expression des g nes

    des gènes à expression constitutive. Ex : gène dont les produits sont impliqués dans le métabolisme D'autre sont exprimés selon le besoin de la cellule. Se sont des gènes régulés. Ex : gène dont les produits sont impliqué dans la croissance et la division cellulaire gène impliqué dans le métabolisme du lactose La régulation de la synthèse du transcrit d'un gène et de son produit est appelée régulation de l'expression d'un gène. Les bactéries peuvent réguler leur expression génique à plusieurs...

    1518  Mots | 6  Pages

  • les maladies génétique

    les maladies génétique Introduction Les maladies génétiques sont des maladies dues à une ou plusieurs anomalies sur un ou plusieurs chromosomes qui entrainent un défaut de fonctionnement de certaines cellules de l'organisme. Ces cellules fabriquent des protéines. L'activité et la structure de chaque protéine est déterminée par l'information génétique contenue dans un gène. Si le gène est affecté, il entraîne la cellule dans un dysfonctionnement, qui peut se déclarer à tout moment de la vie, par...

    1340  Mots | 6  Pages

  • Fiche révision

    l'interphase Interphase, l'info génétique de la cellule-mère est copiée. Chromatide = molécule d'ADN, constituant un brin du chromosome. Chromosome : une ou deux chromatides. L'interphase comprend trois phases : La phase G1, pendant laquelle chaque chromosome comporte une chromatide. La phase S, duplication de la molécule d'ADN. Cela se fait au niveau des yeux de réplication. La phase G2, chromosome constitué de deux chromatides sœurs : même info génétique. B) Le mécanisme de la réplication ...

    1496  Mots | 6  Pages

  • Les maladies genetique

    - Support de Cours (Version PDF) - Les maladies génétiques "complexes" Collège National des Enseignants et Praticiens de Génétique Médicale Dr Francis Vasseur Maître de Conférences en Génétique Praticien Hospitalier Clinique de Santé Publique - Pôle S3P Parc Eurasanté CHRU de Lille Date de création du document 2010-2011 - © Université Médicale Virtuelle Francophone - - Support de Cours (Version PDF) - Table des matières I Présentation....................................

    9775  Mots | 40  Pages

  • Biodiversité

    biologique lorsque l'on veut évoquer l'éventail des modes de vie d'un ou de plusieurs organismes, de diversité spécifique ou diversité floristique lorsque l'on veut débattre de la diversification des espèces végétales, de diversité génétique lorsque l'on évoque la variabilité intraspécifique(Qui se passe dans une espèce, et non en dehors d'elle), la diversité fonctionnelle pour définir les fonctions clefs assurées par un groupe d'espèce… Finalement, le terme de biodiversité est généralement restreint...

    1267  Mots | 6  Pages

  • ecologie l1

    Création terme « Biodiversité » par Edward O.Wilson 1922: Idée de développement durable => convention Biodiversité: - 3 niveaux de perception: Génétique Spécifique: espèces Écologique: interactions (liens) - Comprend la diversité au seins des espèces et entre espèces (variabilité génétique => Patrimoine génétique)ainsi que celle des écosystèmes Plan: I. Organisme vivants et leurs environnements II. Écosystèmes et flux d'énergies ...

    758  Mots | 4  Pages

  • Resumés des cours de svt terms obliagtoire

    les Vertébrés – L’établissement de phylogénies La lignée humaine – La place de l’Homme dans le règne animal 2e PARTIE : Stabilité et variabilité des génomes et évolution Les innovations génétiques Les innovations génétiques et l’évolution des espèces Méiose et fécondation participent à la stabilité de l’espèce Méiose et fécondation sont à l’origine du brassage génétique 3e PARTIE : La mesure du temps dans l’histoire de la Terre et de la Vie La datation relative des évènements géologiques ...

    8161  Mots | 33  Pages

  • De l'évolution à la génétique

    De l’évolution à la génétique (1790 – 1920) I. 1790 – 1830 : débats transformistes en France La première plus grande invention de l’évolution, c’est la prise de conscience progressive que la Terre n’a pas toujours été la même, qu’elle a une histoire très longue et que l’homme a été absent une grande partie de cette histoire. Transformisme : mouvement de pensées qui soutient l’idée que les espèces ne sont fixes, et qu’elles peuvent se transformer au cours du temps les unes dans les autres. La...

    5606  Mots | 23  Pages

  • Devoir_Surveille_commun_premieres_S_type_bac_Maria_Bassil_et_Joyce_Raad_GLFL_cle4d7151 1

    autorisé. Dès que le sujet vous est remis assurez-vous qu’il est complet. Ce sujet comporte 6 pages numérotées de 1 à 6. La page 6 est à rendre anonyme avec la copie double. PARTIE I (10 points) Thème 1 – A: Expression, stabilité et variation du patrimoine génétique Depuis les travaux de génétique et surtout depuis la première bombe atomique, les mutations fascinent les artistes spécialisés dans le fantastique, que ce soit en littérature en bandes dessinées ou au cinéma. A partir...

    974  Mots | 7  Pages

tracking img