L'adn de melanogaster

Pages: 5 (1086 mots) Publié le: 19 mars 2013
SBI 4U Thierno Sow
28 novembre 2012

Laboratoire : Séquençage d’ADN et étude phylogénique

But
Déterminer la séquencede Drosophila melanogaster et la comparé aux 4 autres séquences de Drosophila arizonae, Drosophila mettleri, Drosophila mojavensis et Drosophila nigrospiracula afin de déterminer les mutations ainsi que leur effet.
Hypothèse
En comparant les diverses séquences de Drosophila, on pourra remarquer que ce sont tous des mutations de type «substitution» qui auront un effet de mutation de contre-senspour la grande majorité.
Matériel
- Copie d’une séquence d’ADN
- Tableau de codons
Méthode
Se référer au protocole de laboratoire «Séquençage d’ADN et étude phylogénique» remis par Mme Blake, dans le cours de SBI 4U, à l’école De La Salle, novembre 2012.
Résultats
Voici la séquence d’ADN pour la Drosophila melanogaster :5’-ATTTTGAGGAGCTACTGTAATTACTACTTTATTATCAGCTATCCCTTACTAAGGTATAGATTTAGTTCAA
TGATTATGAGGTGGATTTGCTGTTGTTACTGCCACTTTAACTCGATTTTT-3’
Analyse

1. La séquence d’acides aminés de Drosophila melanogaster est :
Isoleucine, Leucine, Arginine, Sérine, Tyrosine, Cystéine, Asparagine, Tyrosine, Tyrosine, Phénylalanine, Isoleucine, Isoleucine, Sérine, Tyrosine, Proline, Leucine, Leucine, Arginine, Tyrosine, Arginine, Phénylalanine, Sérine, Sérine, Méthionine, Isoleucine,Méthionine, Arginine, Tryptophane, Isoleucine, Cystéine, Cystéine, Cystéine, Tyrosine, Cystéine, Histidine, Phénylalanine, Asparagine, Sérine, Isoleucine, Phénylalanine.
2. Il y a 3 types de mutations ponctuels car les mutations se passent au niveau des nucléotides. Une mutation silencieuse est une mutation qui n’a pas d’impact sur la protéine produite. Une mutation contre-sens est une mutation quidonne une protéine modifié et dont la position influence la fonction. Une mutation non-sens est une mutation qui empêche la formation d’une protéine fonctionnelle. (Bla bla…).
TABLEAU DE MUTATIONS CI-DESSOUS
3.
4.
5. Selon les séquences de codons entres les 5 séquences de Drosophila, les espèces les plus apparentés ou qui auraient l’ancêtre commun le plus près sont le Drosophila arizonae et leDrosophila mojavensis. Parce que tous les nucléotides des 2 espèces sont semblables à part de 2 différences d’acides aminés. Au 17ième codon, il ya une proline pour la Drosophila arizonae et une sérine pour la Drosophila mojavensis et au 34ième codon, il ya une cystéine pour la Drosophila arizonae et une arginine pour la Drosophila mojavensis. Un ancêtre en commun en termes d’évolution estl'individu le plus proche dans le temps dont descendent les espèces en question. Si l'on prend n'importe quelle paire d'espèce vivante, elles auront un ancêtre commun, plus ou moins éloigné dans le temps. Par exemple, l'homme et le chimpanzé ont un ancêtre commun récent, tandis que l'homme et le chien ont un ancêtre commun plus ancien.
6. Voir feuille «Arbre Phylogénique» avec le lab.
7. Non, jem’attendrai pas aux même résultats car les introns sont séquences non-codantes qui en résultent que si on essayait de les coder. Ça nous donnerait des protéines erronées et non fonctionnelles.
8. La Drosophila melanogaster est l’organisme le plus étudié dans les recherches biologiques, particulièrement en génétique. Elle a été essentielle dans les découvertes en ce qui concerne la cartographie des gènes,les allèles multiples et l’hérédité liée au sexe. Elle se reproduit facilement en captivité. Ce qui rend la vie vraiment facile quand on veut étudier différentes générations ou races. Elles ont un grand degré de fécondité, une femelle peut produire 100 œufs en un jour. Peut-être même 2000 dans sa vie. On peut facilement différencier les mâles et les femelles, et aussi les femelles vierges....
Lire le document complet

Veuillez vous inscrire pour avoir accès au document.

Vous pouvez également trouver ces documents utiles

  • L'adn
  • L'ADN
  • L'adn
  • L'ADN
  • L'adn
  • L'adn
  • L'adn
  • L'adn

Devenez membre d'Etudier

Inscrivez-vous
c'est gratuit !