Biomineraux

Pages: 8 (1873 mots) Publié le: 19 juillet 2013
Exercice 1
1) Identifier les bases présentes dans les structures suivantes :

A = adénosine et guanine, B = uracile, C = cytosine, D = thymine 2) Parmi ces bases, lesquelles : a) contiennent du ribose. b) contiennent du désoxyribose. c) contiennent une purine. d) contiennent une pyrimidine e) contiennent de la guanine. f) sont des nucléosides. g) sont des nucléotides. h) se trouvent dansl’ARN. i) se trouvent dans l’ADN. 3) indiquer les extrémités 5’ et 3’ de la molécule A

B A, C A B, C, D A B A (dinucléotide), C B A, C, D

5’

3’

et ceci sur la base de la représentation schématique suivante de la structure de l’ADN :

polyanions

ADN

ARN

Exercice 2
La séquence d’un ADN bicaténaire (double brin), correspondant à un gène, est partiellement reportée ci-dessous. 5’ATACGGGATCCGAGCTCTCGATCGTCTGCAGAAATTCC 3’ 1) Ecrire la séquence et l’orientation du second brin de ce fragment. 3’ TATGCCCTAGGCTCGAGAGCTAGCAGACGTCTTTAAGG 5’ Soit si l’on respecte les conventions d’écriture : 5’ GGAATTTCTGCAGACGATCGAGAGCTCGGATCCCGTAT 3’ 2) Donner le brin complémentaire d’ARN L’uracile remplace la thymine 3’ UAUGCCCUAGGCUCGAGAGCUAGCAGACGUCUUUAAGG 5’ Soit : 5’GGAAUUUCUGCAGACGAUCGAGAGCUCGGAUCCCGUAU 3’ 3) Sur une représentation détaillée de l’enchaînement de deux nucléotides d’un brin d’ADN « du site BamH I » dont les bases seront représentées par les lettres correspondantes, indiquer (à l’aide d’une flèche) quelle liaison est rompue sous l’action de l’enzyme BamH I.
Axe de symétrie

On rappelle que la spécificité des endonucléases de restriction est de : ! ! Reconnaitre desséquences de bases spécifiques dans la double hélice d’ADN - 4 à 15 paires de bases - usuellement des palidromes Cliver les deux brins du duplex en des endroits très spécifiques par hydrolyse de la liaison phosphodiester pour obtention d’un fragment de restriction

4) Soient les enzymes de restriction BamH I, Pst I, Xho I et Mbo I dont les sites reconnus sont : BamH I : 5' G/GATCC 3' ; Pst I :5' CTGCA/G 3' ; Xho I : 5' C/TCGAG 3' ; Mbo I : 5' /GATC 3'. Recopier la séquence de l’ADN et encadrer les sites de restriction en indiquant la position des coupures. en surligné, les sites reconnus respectivement par les enzymes avec en noir, la coupure correspondante
BamHI MboI Pst I

5’ ATACGGGATCCGAGCTCTCGATCGTCTGCAGAAATTCC 3’ 3’ TATGCCCTAGGCTCGAGAGCTAGCAGACGTCTTTAAGG 5’
BamH I : 5' G/GATCC3’ 3’ CCTAG/G 5’ 5’ CTGCA/G 3’ 3’ G/ACGTC 5’ 5’ C/TCGAG 3’ 3’ GAGCT/C 5’

Pst I :

Xho I :

Xho I ne reconnaît pas de site sur ce fragment d’ADN donc n’aura pas d’action (attention à l’orientation du fragment d’ADN) Mbo I : 5’ /GATC 3'. 3’ /CTAG 5’

5) Pour chaque enzyme, écrire les séquences des extrémités des molécules d’ADN digérées et préciser le type d’extrémités obtenu. Pour BamH I(terminaisons à bouts collants) Fragment 1 : 5’ ATACGG 3’ TATGCCCTAG Fragment 2 : GATCCGAGCTCTCGATCGTCTGCAGAAATTCC 3’ GCTCGAGAGCTAGCAGACGTCTTTAAGG 5’

Pour Pst I (terminaisons à bouts collants) Fragment 1 : 5’ ATACGGGATCCGAGCTCTCGATCGTCTGCA 3’ TATGCCCTAGGCTCGAGAGCTAGCAG Fragment 2 : GAAATTCC 3’ ACGTCTTTAAGG 5’

Pour Mbo I (terminaisons à bouts francs) Fragment 1 : 5’ ATACGGGATCCGAGCTCTC 3’TATGCCCTAGGCTCGAGAG Fragment 2 : GATCGTCTGCAGAAATTCC 3’ CTAGCAGACGTCTTTAAGG 5’

6) On mélange ce brin d’ADN apparié avec son brin complémentaire à un autre fragment d’ADN double brin. La solution est portée à une température supérieure à leurs Tm respectives, puis refroidie. Que peut-on attendre? Les brins dissociés (dénaturés) d’ADN de chaque espèce vont se réapparier (se renaturer) avec leurséquence complémentaire sans mélange d’ADN des deux espèces. L’appariement des bases complémentaires est le plus stable énergétiquement. 8) Voici la séquence d’une amorce (ou primer) : 5’ - TTTCTGCA- 3’ Où cette amorce se fixera-t-elle sur la séquence d’ADN ? Quelle séquence obtiendra-t-on après élongation par la DNA-polymérase ? 3’ -ACGTCTTT- 5’ 5’ ATACGGGATCCGAGCTCTCGATCGTCTGCAGAAATTCC 3’ En...
Lire le document complet

Veuillez vous inscrire pour avoir accès au document.

Devenez membre d'Etudier

Inscrivez-vous
c'est gratuit !