Sciences de la vie

270 mots 2 pages
Question 1 : définir le phénotype à plusieurs échelles
Enzyme G6PD active : eau oxygénée transformée phénotype moléculaire sain
Enzyme G6PD inactive : eau oxygénée non transformée phénotype moléculaire malade
Hématie fonctionnelle, sans eau oxygénée phénotype cellulaire sain
Hématie détruite par l’accumulation d’eau oxygénée phénotype cellulaire malade
Pas de symptômes, bonne respiration des organes phénotype macroscopique sain
Crises d’anomalie respiratoire phénotype macroscopique malade
EXERCICE 2 PAGE 64 : HORMONE ET CODE GENETIQUE
1° partie de la question : découpage des séquences en triplet
TGCTACATCCAGAACTGCCCCCTGGGC
On sait que le code génétique est organisé en triplet
TGC TAC ATC CAG AAC TGC CCC CTG GGC.
2° partie de la question : séquence d’acides aminés des deux hormones
CYSTEINE TYROSINE ISOLEUCINE GLUTAMINE ASPARAGINE CYSTEINE PROLINE LEUCINE GLYCINE
EXERCICE 3 PAGE 65 : SEQUENCE DE GENE A PARTIR DE LA PROTEINE

MET- enképhaline = MET-PHE-GLY-GLY-TYR
On sait que les acides amines correspondent à un ou quelques triplets de nucléotides.
À partir du code génétique : MET désigné par ATG
PHE TTT ou TTC
GLY GGT ou GGC ou GGA ou GGG
TYR TAT ou TAC ou TAA
Pour les acides aminés PHE, GLU et TYR, il y a plusieurs triplets possibles. Il n’y a donc pas une seule séquence de nucléotides pouvant déterminer cette séquence d’acides aminés.
Question 2 : nombre de séquences génétiques possibles
MET : 1 triplet ; PHE : 2 triplets ; GLY : 4 triplets ; 2 molécules successives de GLY ; TYR : 3 triplets.
Le nombre de possibilités de séquence de nucléotides différentes correspond au nombre de combinaisons possibles de ces triplets : 1 x 2 x 4 x 4 x 3 = 96 combinaisons possibles : 96 séquences

en relation

  • Science & vie
    590 mots | 3 pages
  • Science de la vie
    495 mots | 2 pages
  • Science et vie
    2409 mots | 10 pages
  • science de la vie
    884 mots | 4 pages
  • Science vie
    454 mots | 2 pages
  • Sciences de la vie
    320 mots | 2 pages
  • sciences de la vie
    1012 mots | 5 pages
  • science et vie politique
    14457 mots | 58 pages
  • Science et vie- Infertilité
    320 mots | 2 pages
  • Sciences de la vie et de la terre
    345 mots | 2 pages