correction ds de svt

Pages: 2 (613 mots) Publié le: 2 novembre 2015
Correction du DS n°3

I) Questions a choix multiple

*La transcription de l'ADN des eucaryotes
donne naissance à un ARN pré-méssager
consiste à copier l'un des deux brins de la molécule
*Le codegénétique
est le système de correspondance mis en jeu lors de la traduction de l'information
*L'ARN pré-méssager
est complémentaire de l'un des deux brins de l'ADN
peut être à l'origine, après maturation,de plusieurs protéines différentes
*Les protéines présentes dans une cellule :
sont constituées d'un enchaînement d'acides aminés
définissent le phénotype moléculaire
*Une molécule d'ADN :
esttranscrite en ARN pré-méssager
*Les protéines :
dépendent du patrimoine génétique de la cellule où elles sont synthétisées
définissent le phénotype moléculaire
*La synthèse des protéines :
est réalisée parun ribosome à partir de l'ARNm et d'acides aminés présents
*Le code génétique :
permet de faire correspondre un codon de l'ARN à un acide aminé
n'a pas d'exception dans le monde vivant (il estuniverselle)

II) Exercice 1 : de l'ADN à la protéine

Q1 : On sait que l'ADN est localisé dans le noyau et que les points noirs représentent les acides aminés permettant de fabriquer les protéines, or onsait que celles-ci sont fabriquer dans le cytoplasme. Grâce au marquage radioactif on remarque que, lors de la culture A, les acides aminés sont localisés dans le noyau et que lors de la culture B, lesacides aminés sont localisés dans le cytoplasme. Il y a donc un intermédiaire entre l'ADN et les protéines, appelé ARN, capable de traverser les pores nucléaires du noyau pour arriver dans lecytoplasme où la protéine sera fabriquer.

Q2 : TACGTTACGCATGGCTGCACT
*Allèle non muté :
AUGCAAUGCGUACCGACGUGA
MetGlnCysValProThr
*Allèle muté 1 :
AUGCAACGCGUACCGACGUGA
MetGlnCysValProThr
*Allèle muté 2 :AUGCAACGCGUACCGACGUGA
MetGlnArgValProThr

Q3 : La propriété mise en évidence par la mutation n°1 est la redondance génétique : un même acide aminé peut être codé par plusieurs codons.

Q4 : Cela va...
Lire le document complet

Veuillez vous inscrire pour avoir accès au document.

Vous pouvez également trouver ces documents utiles

  • elc3a9ments de correction devoir de svt ds 5
  • Correction ds
  • Ds svt
  • DS correction
  • Correction ds
  • Svt ds
  • Svt ds
  • SVT correction

Devenez membre d'Etudier

Inscrivez-vous
c'est gratuit !